Origin

Synthesized by company.

Properties

Inhibition of Profilin-3 (PFN3) expression.

Usage and Biology

siPFN3-3 inhibits the target gene PFN3 as a small interfering RNA (siRNA). PFN3 is an actin-binding protein that is crucial for cytoskeletal dynamics in plants. Its conserved structure across plant taxa makes it a potent cross-reactive allergen (Rodríguez Del Río et al., 2018). Up to 20% of pollen allergies are triggered by profilins, with PFN3 being the greatest cause (Landa-Pineda et al., 2013). siRNA is a key component of the RNAi process, a powerful gene silencing mechanism. Once introduced into target cells, it is recognized and loaded into the RNA-Induced Silencing Complex (RISC). The siRNA’s antisense strand binds to the complementary target mRNA molecule, triggering the RISC complex to cleave the target mRNA and prevent it from being translated into a functional protein (Agrawal et al., 2003). The silencing effect typically lasts around 12 days.

siPFN3-3 is useful in plant cells, where it successfully inhibits the expression of the pan-allergen PFN3, alleviating and reducing allergic symptoms related to *Populus tomentosa* pollen allergy.

Cultivation and Purification

The part sequence we have registered is its corresponding DNA sequence, which needs to be transcribed into RNA sequence for use. The following sequences are siRNA sequences.

siPFN3-3 is synthesized through oligonucleotides with a nucleic acid synthesizer. The following sequences represent the sense and antisense strands of the siRNA:

- Oligo Sequence for siPFN3-3-SS: GGAGCUGUGAUUCGUGGAAAG

- Oligo Sequence for siPFN3-3-AS: UUCCACGAAUCACAGCUCCGG

These oligonucleotides are then annealed to form a double-stranded siRNA molecule. The siRNA is purified using high-performance liquid chromatography (HPLC) (Sohail et al., 2003). To enhance delivery into plant cells, carbon dots (CDs) were incorporated with Polyethyleneimine (PEI) through the microwave method, allowing the negatively charged siRNA to bind to the CDs.

Measurement and Characterization

In this project, we utilized RT-qPCR technology to assess the expression levels of the target gene. We employed a relative quantification method that standardizes the expression of the target gene across different samples using a reference gene. Specifically, we compared the Ct values of the target gene in experimental samples with those in control samples, with the results expressed as the ratio or fold change in the target gene expression between the experimental and control samples.

In our experiments, we selected β-actin as the reference gene for normalization. By normalizing the expression levels, we derived the fold change of the target gene expression in the experimental samples relative to the control samples. The normalized expression level of the target gene in the control samples was set to "1", while the normalized expression levels in the experimental samples were reported as the fold increase or decrease compared to the control. This calculation was performed using the 2^-(∆∆Ct) method, which effectively reflects the relative expression levels of the target gene across different samples.

Figure 1. RT-qPCR results for protoplasts.

The chart demonstrates the performance of siPFN3-3 in inhibiting PFN3 expression. Results show that siPFN3-3 was unable to repress PFN3 expression, and the increase in PFN3 expression may be attributed to normal fluctuations in gene expression. Further trials are needed to verify its efficacy in other contexts.

Figure 2. RT-qPCR results for tobacco leaf injection.

RT-qPCR results for siRNA injection in tobacco leaves. siPFN3-3, when combined with CDs, showed some success in repressing PFN3 expression, although the efficacy was lower compared to siPFN3-2.

Figure 3. RT-qPCR results for osmanthus tree trunk injection.

RT-qPCR results for siRNA delivery through trunk injection in osmanthus trees. siPFN3-3 did not demonstrate success in inhibiting PFN3 expression with CDs, and expression levels even increased. However, the results may be inconclusive due to insufficient time for the tree to fully process the siRNA. Further trials are necessary to determine the effectiveness of siPFN3-3 in different contexts.

Further trials and improvements are needed to ensure optimal efficacy of siPFN3-3 in target gene repression.

Reference

Landa-Pineda C. M., Guidos-Fogelbach G., Marchat-Marchau L., López-Hidalgo M., Arroyo-Becerra A., & Sandino Reyes-López C. A. (2013). Profilinas: alergenos con relevancia clínica [Profilins: allergens with clinical relevance]. *Revista Alergia Mexico*, 60(3), 129–143.

Rodríguez Del Río P., Díaz-Perales A., Sánchez-García S., Escudero C., Ibáñez M. D., Méndez-Brea P., & Barber D. (2018). Profilin, a Change in the Paradigm. *Journal of Investigational Allergology & Clinical Immunology*, 28(1), 1–12. [1](https://doi.org/10.18176/jiaci.0193)

Sohail M., Doran G., Riedemann J., Macaulay V., & Southern E. M. (2003). A simple and cost-effective method for producing small interfering RNAs with high efficacy. *Nucleic Acids Research*, 31(7), e38.

Part:BBa_K5375011

Contents